JWB

Joined

• started 56 topics
• posted 319 times   see topics posted on
• send a message

Posts by JWB

• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  cantleave, please reread my original post. This is an encoded message using the letters ACGT to form base 4 values.
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  cantleave, here is a clue: base 4 - as opposed to binary/hexadecimal/octal.
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  CAN ANYONE DECODE THIS?
  
  CATGACAAATTTCACCAATTCGAATAGCCGCC
  
  This is not a trick question. In order to solve this problem you will need to be familiar with how computer memory stores digital information. You will also need to have knowledge of an extremely simple encryption method. With these at your disposal it should not take long to decode the message.
• 
  47

  Day One After Armgeddon written by a JW awaiting the Big A w/eager expectation - Warning: LOOOONG!!!

  by Eve Deceived in

  1. watchtower
  2. beliefs

  once we found out we were all witnesses, we all hugged.

  now we just had to see if our kingdom hall was still standing.

  when we came to the hall we had such a huge shock.. there were so many people there.

  1. 
  2. 
  3. 
• 

  JWB

  Yes Comatose, and what on earth would an Armageddon survivor be doing mowing a lawn so soon afterwards anyway. I would've thought the first job would be to bury all the dead. "Come on everybody, little ones as well, we've got a great work to do before we can build our wonderful new homes. Nobody wants to smell the awful stench of decaying bodies forever do they?"
• 
  12

  The Power of Eight

  by JWB in

  1. jw
  2. friends

  the power of eight.

  in the first paragraph on page 26 of the 15 june 2013 watchtower we read:.

  "on wednesday morning, september 5, 2012, it was announced to the united states and canada bethel families that a new member had been added to the governing body of jehovahs witnesses.

  1. 
  2. 
  3. 
• 

  JWB

  DesirousOfChange, I think you're right. Didn't they have as many as 17 members at one time?
• 
  22

  CANADA | Toronto Star | May 3, 2013 - Jehovah's Witnesses: Kindness is an act of grace - not an obligation

  by jwleaks in

  1. jw
  2. friends

  who should be responsible for financially supporting jehovah's witnesses, who put misguided faith in the failed 1975 "end-of-the-world" predictions, and went full-time preaching without any consideration for retirement many years later?.

  kindness is an act of grace not an obligationare successful brothers ethically required to help aging moneyless sister?

  toronto star.

  1. 
  2. 
  3. 
• 

  JWB

  "If a brother or sister be naked and in lack of daily food, and one of you say unto them, Go in peace, be ye warmed and filled; and yet ye give them not the things needful to the body; what doth it profit? Even so faith, if it have not works, is dead in itself." - James 2:15-17 (ASV)
• 
  12

  The Power of Eight

  by JWB in

  1. jw
  2. friends

  the power of eight.

  in the first paragraph on page 26 of the 15 june 2013 watchtower we read:.

  "on wednesday morning, september 5, 2012, it was announced to the united states and canada bethel families that a new member had been added to the governing body of jehovahs witnesses.

  1. 
  2. 
  3. 
• 

  JWB

  "An octopus's main (primary) defense is to hide, either not to be seen at all, or through camouflage and mimicry not to be detected as an octopus. Octopuses have several secondary defenses (defenses they use once they have been seen by a predator). The most common secondary defense is fast escape. Other defenses include distraction with the use of ink sacs and autotomising limbs. Most octopuses can eject a thick, blackish ink in a large cloud to aid in escaping from predators. The main coloring agent of the ink is melanin, which is the same chemical that gives humans their hair and skin color. This ink cloud is thought to reduce the efficiency of olfactory organs, which would aid an octopus's evasion from predators that employ smell for hunting, such as sharks. Ink clouds of some species might serve as pseudomorphs, or decoys that the predator attacks instead." [en.wikipedia.org/wiki/Octopus]
• 
  12

  The Power of Eight

  by JWB in

  1. jw
  2. friends

  the power of eight.

  in the first paragraph on page 26 of the 15 june 2013 watchtower we read:.

  "on wednesday morning, september 5, 2012, it was announced to the united states and canada bethel families that a new member had been added to the governing body of jehovahs witnesses.

  1. 
  2. 
  3. 
• 

  JWB

  Gayle, I like the pics!
• 
  45

  New Explanation On United Nations Membership From Circuit Overseer.

  by ÁrbolesdeArabia in

  1. watchtower
  2. beliefs

  i had the chance to speak with a circuit overseer, he was not my circuit overseer and it was my chance to get the offical party line why the watchtower joined the united nations.. .

  "are you a jehovah witness he asked me?

  (theocratical warfare allows lies according to the gb!

  1. 
  2. 
  3. 
• 

  JWB

  Sayswho, very good information!

  In answer to your question: "So if it was not wrong...why did they keep it secret from almost all JW'S ?---even to this day!" My opinion is that:

  (1) They can't bear to be seen as making a huge mistake (if indeed it was).

  (2) They will not apologise for anything - it might sort of dent their 'holy' image.

  (3) They are hypocites.
• 
  54

  AUSTRALIA | TRANSCRIPT of Child Abuse Inquiry into Jehovah's Witnesses and Watchtower Society - April 2013

  by jwleaks in

  1. watchtower
  2. child-abuse

  jw leaks has published the 17 page official transcript of the appearance by watchtower bible and tract society of australia and jehovah's witnesses before the "inquiry into the handling of child abuse by religious and other organisations" conducted on 11 april 2013 in victoria, australia.. http://jwleaks.org/australia/.

  quote from rachel van witsen, legal counsel for watchtower bible and tract society of australia and jehovah's witnesses, in reply to who is responsible for reporting child abuse within the religion of jehovah's witnesses... .

  ms van witsen at the moment, because there is no mandatory reporting for ministers of religion in victoria, then the victim, who has very often had their dignity removed, is then put in the drivers seat.. .

  1. 
  2. 
  3. 
• 

  JWB

  Thanks DATA-DOG for bringing this out. It did cross my mind that there might be some deliberate choosing of words and omissions so that there could be no legitimate accusation of lying. However, as you have pointed out the term 'minister' has been applied by the Society on numerous occasions as applying to ALL baptized members. Unfortunately, the government representatives were at a disadvantage in not knowing this. I feel sure that had they known this they would have probed deeper and hopefully forced an unambigious answer as to the extent of child-abuse cases within the organization. The particular speciality of lawyers is words and terms. With the careful choice of words and even omission of certain words very important information may not come to the attention of those who need to know.