Can anyone decode this? (page 2)

JWB

cantleave, I'm glad you liked that! It just goes to show that there are so many ways that digital information can be stored.

Turd Ferguson

JWB; Speaking of "digital information" stored in odd, for lack of a better word, "natural" places...

What are your collective thoughts on this: (the pertinent part is around the 5 minute mark)

http://www.youtube.com/watch?v=9Z9tO0D6W-Y

Turd Ferguson

http://www.youtube.com/watch?v=9Z9tO0D6W-Y

Tf, I watched the above-mentioned video. I was interested in the comment about the possibility of a real matrix-style world based on natural hidden "computer codes". I understand that our perception of 'reality' is only that which our mind decides based on the information coming to the brain via our senses. This is why when we hear someone talking to us on the phone it seems as if we are actually hearing their voice, but really we are only getting a copy of the sounds they make after the coding and decoding processes necessary for sending data down telephone lines and the reconstruction made in the speaker contained in the earpiece.

Dr Gates makes the observation that if you "fall in love" with something you will naturally want to pursue it. This is something I discovered about myself when it came to computers and coding. This was some decades ago. Personal computers and programmable games machines were starting to become more affordable and naturally I wanted a computer of my own!

I wasn't interested in playing games, I just wanted to be able to create something. I got some books out of the library and started to understand how computers stored information. The complex architecture and system necessary to even output one character to the screen had my mind swirling at first. Thankfully we had reached a point in history where it was no longer necessary to labour with machine code as high level computer languages were available to take out much of the pain. Nevertheless I had to wait some years later before the convenience and speed afforded by Integrated Development Environments (IDEs) and Rapid Application Development Tools (RADs) came along.

After going 'back to college' and getting a formal education in systems development, I ended up spending the last 20 years or so being involved in computer information systems, first in application development, then in systems administration. I've witnessed huge leaps in technology, but at the base level I realise that all of this could not have taken place unless there had been some very brilliant minds involved. My interest in DNA is as a result of my computer background, and particularly because of my exposure to the intricacies of software development. I see in DNA and RNA similarities with machine code. For example, there is data storage and retrieval as well as data reading/writing 'start' and 'stop' codes. As Spock would say, "Fascinating!"

---

If anyone is interesting in another code challenge, see if you can decode this message:

TGTGTTGATGTTAATATGGAATCTTCTGCTGGTGAATCTGCTCGTGAAGGTCGTGAAGCTACT

The only clues I'll give are: (1) The method of solving the problem is not the same as the first challenge, and (2) you will need to have a basic understanding of DNA 'codons' and certain information pertaining to them.

This is possibly easier than the first challenge, but no guesses allowed as I expect you to explain how you cracked the code this time!

JWB

Well, maybe the second challenge was a bit ambiguous, so I'll make it very easy. Please see the tables below.

JWB

DNA CODONS: AMINO ACIDS (1)

Id	Sym	Name	Codon(s)
A	Ala	alanine	GCT, GCC, GCA, GCG
C	Cys	cysteine	TGT, TGC
D	Asp	aspartic acid	GAT, GAC
E	Glu	glutamic acid	GAA, GAG
F	Phe	phenylalaline	TTT, TTC
G	Gly	glycine	GGT, GGC, GGA, GGG
H	His	histidine	CAT, CAC
I	Ile	isoleucine	ATT, ATC, ATA
K	Lys	lysine	AAA, AAG
L	Leu	leucine	TTA, TTG, CTT, CTC, CTA, CTG
M	Met	methianine	ATG (also used as start code)
N	Asn	asparagine	AAT, AAC
P	Pro	proline	CCT, CCC, CCA, CCG
Q	Gln	glutamine	CAA, CAG
R	Arg	arginine	CGT, CGC, CGA, CGG, AGA, AGG
S	Ser	serine	TCT, TCC, TCA, TCG, AGT, AGC
T	Thr	threonine	ACT, ACC, ACA, ACG
V	Val	valine	GTT, GTC, GTA, GTG
W	Trp	tryptophane	TGG
Y	Tyr	tyrosine	TAT, TAC
_	-	(stop code)	TAA, TGA, TAG

DNA CODONS: AMINO ACIDS (2)

Id	Sym	Name	Codon	#
F	Phe	phenylalaline	TTT	01
F	Phe	phenylalaline	TTC	02
L	Leu	leucine	TTA	03
L	Leu	leucine	TTG	04
S	Ser	serine	TCT	05
S	Ser	serine	TCC	06
S	Ser	serine	TCA	07
S	Ser	serine	TCG	08
Y	Tyr	tyrosine	TAT	09
Y	Tyr	tyrosine	TAC	10
_	-	(stop code)	TAA	11
_	-	(stop code)	TAG	12
C	Cys	cysteine	TGT	13
C	Cys	cysteine	TGC	14
_	-	(stop code)	TGA	15
W	Trp	tryptophane	TGG	16
L	Leu	leucine	CTT	17
L	Leu	leucine	CTC	18
L	Leu	leucine	CTA	19
L	Leu	leucine	CTG	20
P	Pro	proline	CCT	21
P	Pro	proline	CCC	22
P	Pro	proline	CCA	23
P	Pro	proline	CCG	24
H	His	histidine	CAT	25
H	His	histidine	CAC	26
Q	Gln	glutamine	CAA	27
Q	Gln	glutamine	CAG	28
R	Arg	arginine	CGT	29
R	Arg	arginine	CGC	30
R	Arg	arginine	CGA	31
R	Arg	arginine	CGG	32
I	Ile	isoleucine	ATT	33
I	Ile	isoleucine	ATC	34
I	Ile	isoleucine	ATA	35
M	Met	methianine*	ATG	36
T	Thr	threonine	ACT	37
T	Thr	threonine	ACC	38
T	Thr	threonine	ACA	39
T	Thr	threonine	ACG	40
N	Asn	asparagine	AAT	41
N	Asn	asparagine	AAC	42
K	Lys	lysine	AAA	43
K	Lys	lysine	AAG	44
S	Ser	serine	AGT	45
S	Ser	serine	AGC	46
R	Arg	arginine	AGA	47
R	Arg	arginine	AGG	48
V	Val	valine	GTT	49
V	Val	valine	GTC	50
V	Val	valine	GTA	51
V	Val	valine	GTG	52
A	Ala	alanine	GCT	53
A	Ala	alanine	GCC	54
A	Ala	alanine	GCA	55
A	Ala	alanine	GCG	56
D	Asp	aspartic acid	GAT	57
D	Asp	aspartic acid	GAC	58
E	Glu	glutamic acid	GAA	59
E	Glu	glutamic acid	GAG	60
G	Gly	glycine	GGT	61
G	Gly	glycine	GGC	62
G	Gly	glycine	GGA	63
G	Gly	glycine	GGG	64

* also used as start code

JWB

No takers?

Well, here's the answer:

JWB

Overview of DNA and RNA transcription functions

http://www.youtube.com/watch?v=yqESR7E4b_8

Learn About the Replication and Transcription of DNA (Deoxyribonucleic acid)

http://www.youtube.com/watch?v=zFVH9SqtJCM

[Edited to include introductory video. The second video goes into a lot more detail]

Can anyone decode this?

cantleave

JWB

St George of England

Turd Ferguson

Turd Ferguson

JWB

JWB

JWB

JWB

JWB

Share this