For those who don't have access to a copy of Strongs:
#5773 - `W`YM (ayin waw ayin yod mem)
http://www.blueletterbible.org/lang/lexicon/lexicon.cfm?Strongs=H5773&t=NASB
1) distorting, perverting, warping
#5753 - `WH (ayin waw he)
http://www.blueletterbible.org/lang/lexicon/lexicon.cfm?Strongs=H5753&t=NASB
1) to bend, twist, distort
a) (Niphal) to be bent, be bowed down, be twisted, be perverted
b) (Piel) to twist, distort
c) (Hiphil) to do perversely
2) to commit iniquity, do wrong, pervert
a) (Qal) to do wrong, commit iniquity
b) (Hiphil) to commit iniquity
#3050 - YH (yod he)
http://www.blueletterbible.org/lang/lexicon/lexicon.cfm?Strongs=H3050&t=NSAB
1) Jah (Jehovah in the shortened form)
a) the proper name of the one true God
b) used in many compounds
1) names beginning with the letters 'Je'
2) names ending with 'iah' or 'jah'
Posts by JWB
-
150
YHWH v YHVH - yes, V not W
by *lost* ingod's real name and identity yhvh.
yhwh - fraudulent identity.. .
can we all sue wt for evidenced fraud and deliberate deception ??
-
JWB
-
123
Who is the "True God of the Bible" ?
by Phizzy ini decided to ask this on the back of "lost"'s thread about yhvh etc.. quite often on here we get bible believers trying to tie the whole mess that is the bible together, and maintaining that it tells us about just one "true" god.. who is this "true" god, and what is the proof that he is true ?.
was he the god of abraham and melchizedech ?.
the god of the ordinary jew before the babylonian exile ?.
-
JWB
mP, thanks, you explained it so well.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
jwleaks, you're very welcome, and I hope they were of great interest!
-
123
Who is the "True God of the Bible" ?
by Phizzy ini decided to ask this on the back of "lost"'s thread about yhvh etc.. quite often on here we get bible believers trying to tie the whole mess that is the bible together, and maintaining that it tells us about just one "true" god.. who is this "true" god, and what is the proof that he is true ?.
was he the god of abraham and melchizedech ?.
the god of the ordinary jew before the babylonian exile ?.
-
JWB
In my opinion TTGOTB (as depicted in the Hebrew scriptures) was lacking in basic morality.
1) He condemned the whole of humankind, on account of the actions of two people.
2) He particularly targetted women for punishment, by making childbirth literally a pain and put them at a disadvantage by making them 'crave' men who would 'dominate' them.
3) He condemned descendents on account of what their forefathers did ('sins of the fathers visited on the sons').
4) He sometimes required that one should not feel pity towards children but put them to death on account of the actions of their parents.
5) Apart from one occasion, where an angel was reported to be involved, he required that human beings do his work of butchering other human beings.
Seems to me the most likely origin of this immoral person was the mind of someone who 'had issues'.
-
24
Have the leaders of JWs ever said 'sorry'?
by JWB inwell have they?
given that 'we are all imperfect and fall down many times' one would expect them to have made at least some mistakes since rutherford founded the jw religion.
as christians are supposed to be humble, including those who 'would be great among you', should we not have seen evidence of this over such a long time period?.
-
JWB
Well have they? Given that 'we are all imperfect and fall down many times' one would expect them to have made at least some mistakes since Rutherford founded the JW religion. As Christians are supposed to be humble, including those who 'would be great among you', should we not have seen evidence of this over such a long time period?
-
150
YHWH v YHVH - yes, V not W
by *lost* ingod's real name and identity yhvh.
yhwh - fraudulent identity.. .
can we all sue wt for evidenced fraud and deliberate deception ??
-
JWB
"lost", yes I did read from the beginning, but found no proof from what you said that the ancient Israelites pronounced Waw (Vav) like a V. Their is also no 'v' in ancient Greek either - the closest from a modern pronunciation would be ph but but I understand the the Greek letter phi would have been pronounced as a p (but with a hard breath immediately afterwards). What I had hoped for would be a pointer to where in your written text you supplied proof of your assertion, but I didn't get any. Again, don't get me wrong, I'm just trying to see if I've missed something. I think oppostate gave a very good example of how the pronunciation of language has changed over time.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
Overview of DNA and RNA transcription functions
http://www.youtube.com/watch?v=yqESR7E4b_8
Learn About the Replication and Transcription of DNA (Deoxyribonucleic acid)
http://www.youtube.com/watch?v=zFVH9SqtJCM[Edited to include introductory video. The second video goes into a lot more detail]
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
No takers?
Well, here's the answer:
DNA MESSAGE 2
TGTGTTGATGTTAATATGGAATCTTCTGCTGGTGAATCTGCTCGTGAAGGTCGTGAAGCTACT
A | Ala | alanine | GCT, GCC, GCA, GCG
C | Cys | cysteine | TGT, TGC
D | Asp | aspartic acid | GAT, GAC
E | Glu | glutamic acid | GAA, GAG
F | Phe | phenylalaline | TTT, TTC
G | Gly | glycine | GGT, GGC, GGA, GGG
H | His | histidine | CAT, CAC
I | Ile | isoleucine | ATT, ATC, ATA
K | Lys | lysine | AAA, AAG
L | Leu | leucine | TTA, TTG, CTT, CTC, CTA, CTG
M | Met | methianine | ATG (also used as start code)
N | Asn | asparagine | AAT, AAC
P | Pro | proline | CCT, CCC, CCA, CCG
Q | Gln | glutamine | CAA, CAG
R | Arg | arginine | CGT, CGC, CGA, CGG, AGA, AGG
S | Ser | serine | TCT, TCC, TCA, TCG, AGT, AGC
T | Thr | threonine | ACT, ACC, ACA, ACG
V | Val | valine | GTT, GTC, GTA, GTG
W | Trp | tryptophane | TGG
Y | Tyr | tyrosine | TAT, TAC
_ | | (stop code) | TAA, TGA, TAG
c v d v n
TGT GTT GAT GTT AAT
m e s s a g e s
ATG GAA TCT TCT GCT GGT GAA TCT
a r e
GCT CGT GAA
g r e a t
GGT CGT GAA GCT ACT
codon messages are great
Note: Since there is no amino acid with an 'o' as a one-letter symbol, I chose v because of its similarity with u, and u because of its similarity with o. -
37
July KM - Jehovah's heart scanner in action
by respectful_observer inexcerpt from july 2013 km article "new initiatives for public witnessing".
4 how the witnessing is done: those.
involved in special metropolitan public.
-
JWB
I hardly think that the Omniscient One (OO) would have to do a scan on Someone's Heart (SH)!
OO: Here comes the next person. SH, do you have anything to declare?
SH: No, you already know what's in here.
OO: Well, I'll still have to do a scan.
SH: Why?
OO: Well, because its necessary before I can decide whether you should talk to My People at the desk.
SH: And then?
OO: If you've got a bad heart, then I'll move you on past My People so as not to waste their time. Otherwise, my Spirit (with the help of the angels of course) will incline you and your host to move into the direction of the desk to discover the latest edition of Truth(tm).
---
For Mary:
"Its life Jim, but not as we know it!" -
150
YHWH v YHVH - yes, V not W
by *lost* ingod's real name and identity yhvh.
yhwh - fraudulent identity.. .
can we all sue wt for evidenced fraud and deliberate deception ??
-
JWB
Lost, please can you enlighten me as to your statement: "There is no ''W'' sound in Hebrew"? Are you referring to modern Hebrew? If so, okay. But I have difficulty believing that the ancient Hebrews didn't have a W sound. The reason for this is that the Waw (Vav) character was used at times to form 'O' and 'U'. This seems reasonable considering that W, O, and U have a relationship in terms of how the mouth produces the sounds. As you are probably aware, many languages over time change the way consonants and vowels are pronounced. One such change is from the I/Y to J. This has happened in the case of Jehovah, where the original I has become J. As another example, many English words that begin with J have actually come from Latin words that began with an I. So I'm intrigued as to the statement you made. I'm not trying to cause an argument, but I simply wish to know if I've missed something here.