I thought it was short for Point Of Presence, well on the internet anyway!
Posts by JWB
-
31
The day JEHOVAH.....went POP!
by Terry inthink about this.. go way back...far far back in history.. .
go back before the internet.
go back farther.. go back before newspapers, tv and radio.. .
-
-
31
The day JEHOVAH.....went POP!
by Terry inthink about this.. go way back...far far back in history.. .
go back before the internet.
go back farther.. go back before newspapers, tv and radio.. .
-
JWB
And don't forget just because "justice is not executed speedily" doesn't mean he won't get on to your case eventually. The wheels of justice may grind exceedingly slow but eventually you'll be held accountable for bad-mouthing the Sovereign of the Universe!
-
31
The day JEHOVAH.....went POP!
by Terry inthink about this.. go way back...far far back in history.. .
go back before the internet.
go back farther.. go back before newspapers, tv and radio.. .
-
JWB
Be careful Terry, Jehovah might read your post and get very very angry with you!
-
4
If Blessings Are Like Miracles, Do You Believe In Miracles?
by LoisLane looking for Superman in.
just lois.
-
JWB
I suppose anything that could not be explained scientifically to the beholder. Just as if someone transported from the 1st century to the 21st century would regard a tablet PC as a miracle. Some UK posters may remember a TV series by the name of Catweazle that featured a Merlin-like character who found himself in the modern world and proclaimed that 'electricity' was 'elec-trickery'!
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
cantleave, I'm glad you liked that! It just goes to show that there are so many ways that digital information can be stored.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
falseprophet, well done!
And for those of you still wondering:
AA = _
AC = a
AG = b
AT = c
CA = d
CC = e
CG = f
CT = g
GA = h
GC = i
GG = j
GT = k
TA = l
TC = m
TG = n
TT = o
d n a _ c o d e _ o f _ l i f e
CA (d) TG (n) AC (a) AA (_)AT (c) TT (o) CA (d) CC (e) AA (_)
TT (o) CG (f) AA (_)
TA (l) GC (i) CG (f) CC (e)
This can also be used to store numbers too in base 4:
AA = 00 (0)
AC = 01 (1)
AG = 02 (2)
AT = 03 (3)
CA = 10 (4)
CC = 11 (5)
CG = 12 (6)
CT = 13 (7)
GA = 20 (8)
GC = 21 (9)
GG = 22 (10)
GT = 23 (11)
TA = 30 (12)
TC = 31 (13)
TG = 32 (14)
TT = 33 (15)---
Here is a real world example of using actually encoding secret messages into DNA. "These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like āvā for āuā) were necessary":
http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/
An interesting idea for synthetic data storage within DNA:
http://blog.longnow.org/02012/08/16/storing-digital-data-in-dna/
(Do you remember those 'gel packs' in Star Trek Voyager? You know, the organic ones that supplemented the main computer's memory?) -
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
Another hint: Each individual part of the code is a pair.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
cantleave, please reread my original post. This is an encoded message using the letters ACGT to form base 4 values.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
cantleave, here is a clue: base 4 - as opposed to binary/hexadecimal/octal.
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
JWB
CAN ANYONE DECODE THIS?
CATGACAAATTTCACCAATTCGAATAGCCGCC
This is not a trick question. In order to solve this problem you will need to be familiar with how computer memory stores digital information. You will also need to have knowledge of an extremely simple encryption method. With these at your disposal it should not take long to decode the message.