JWB

Joined

• started 56 topics
• posted 319 times   see topics posted on
• send a message

Posts by JWB

• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  Well, maybe the second challenge was a bit ambiguous, so I'll make it very easy. Please see the tables below.
• 
  56

  I wanted to punch this elder so bad!

  by OneDayillBeFree in

  1. watchtower
  2. beliefs

  so i decided to attend the meeting last.

  since i haven't gone in about 2 weeks, and i leave as soon as it ends, and elder decided to corner me at the end.

  lately i've been through some very depressing family issues that are non-jw related so i haven't been my best at acting like i care about the org.

  1. 
  2. 
  3. 
• 

  JWB

  He [O'Brien] paused for a few moments, as though to allow what he had been saying to sink in.
  
  'Do you remember,' he went on, 'writing in your diary, "Freedom is the freedom to say that two plus two make four"?'
  
  'Yes,' said Winston.
  
  O'Brien held up his left hand, its back towards Winston, with the thumb hidden and the four fingers extended.
  
  'How many fingers am I holding up, Winston?'
  
  'Four.'
  
  'And if the party says that it is not four but five -- then how many?'
  
  'Four.'
  
  The word ended in a gasp of pain. The needle of the dial had shot up to fifty-five. The sweat had sprung out all over Winston's body. The air tore into his lungs and issued again in deep groans which even by clenching his teeth he could not stop. O'Brien watched him, the four fingers still extended. He drew back the lever. This time the pain was only slightly eased.
  
  'How many fingers, Winston?'
  
  'Four.'
  
  The needle went up to sixty.
  
  'How many fingers, Winston?'
  
  'Four! Four! What else can I say? Four!'
  
  The needle must have risen again, but he did not look at it. The heavy, stern face and the four fingers filled his vision. The fingers stood up before his eyes like pillars, enormous, blurry, and seeming to vibrate, but unmistakably four.
  
  'How many fingers, Winston?'
  
  'Four! Stop it, stop it! How can you go on? Four! Four!'
  
  'How many fingers, Winston?'
  
  'Five! Five! Five!'
  
  'No, Winston, that is no use. You are lying. You still think there are four. How many fingers, please?'
  
  'Four! five! Four! Anything you like. Only stop it, stop the pain!'
  http://www.george-orwell.org/1984/18.html
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  Tf, I watched the above-mentioned video. I was interested in the comment about the possibility of a real matrix-style world based on natural hidden "computer codes". I understand that our perception of 'reality' is only that which our mind decides based on the information coming to the brain via our senses. This is why when we hear someone talking to us on the phone it seems as if we are actually hearing their voice, but really we are only getting a copy of the sounds they make after the coding and decoding processes necessary for sending data down telephone lines and the reconstruction made in the speaker contained in the earpiece.
  
  Dr Gates makes the observation that if you "fall in love" with something you will naturally want to pursue it. This is something I discovered about myself when it came to computers and coding. This was some decades ago. Personal computers and programmable games machines were starting to become more affordable and naturally I wanted a computer of my own!
  
  I wasn't interested in playing games, I just wanted to be able to create something. I got some books out of the library and started to understand how computers stored information. The complex architecture and system necessary to even output one character to the screen had my mind swirling at first. Thankfully we had reached a point in history where it was no longer necessary to labour with machine code as high level computer languages were available to take out much of the pain. Nevertheless I had to wait some years later before the convenience and speed afforded by Integrated Development Environments (IDEs) and Rapid Application Development Tools (RADs) came along.
  
  After going 'back to college' and getting a formal education in systems development, I ended up spending the last 20 years or so being involved in computer information systems, first in application development, then in systems administration. I've witnessed huge leaps in technology, but at the base level I realise that all of this could not have taken place unless there had been some very brilliant minds involved. My interest in DNA is as a result of my computer background, and particularly because of my exposure to the intricacies of software development. I see in DNA and RNA similarities with machine code. For example, there is data storage and retrieval as well as data reading/writing 'start' and 'stop' codes. As Spock would say, "Fascinating!"
  
  ---
  
  If anyone is interesting in another code challenge, see if you can decode this message:
  
  TGTGTTGATGTTAATATGGAATCTTCTGCTGGTGAATCTGCTCGTGAAGGTCGTGAAGCTACT
  
  The only clues I'll give are: (1) The method of solving the problem is not the same as the first challenge, and (2) you will need to have a basic understanding of DNA 'codons' and certain information pertaining to them.
  
  This is possibly easier than the first challenge, but no guesses allowed as I expect you to explain how you cracked the code this time!
• 
  31

  The day JEHOVAH.....went POP!

  by Terry in

  1. watchtower
  2. beliefs

  think about this.. go way back...far far back in history.. .

  go back before the internet.

  go back farther.. go back before newspapers, tv and radio.. .

  1. 
  2. 
  3. 
• 

  JWB

  I thought it was short for Point Of Presence, well on the internet anyway!
• 
  31

  The day JEHOVAH.....went POP!

  by Terry in

  1. watchtower
  2. beliefs

  think about this.. go way back...far far back in history.. .

  go back before the internet.

  go back farther.. go back before newspapers, tv and radio.. .

  1. 
  2. 
  3. 
• 

  JWB

  And don't forget just because "justice is not executed speedily" doesn't mean he won't get on to your case eventually. The wheels of justice may grind exceedingly slow but eventually you'll be held accountable for bad-mouthing the Sovereign of the Universe!
• 
  31

  The day JEHOVAH.....went POP!

  by Terry in

  1. watchtower
  2. beliefs

  think about this.. go way back...far far back in history.. .

  go back before the internet.

  go back farther.. go back before newspapers, tv and radio.. .

  1. 
  2. 
  3. 
• 

  JWB

  Be careful Terry, Jehovah might read your post and get very very angry with you!
• 
  4

  If Blessings Are Like Miracles, Do You Believe In Miracles?

  by LoisLane looking for Superman in

  1. watchtower
  2. beliefs

  .

  just lois.

  1. 
  2. 
  3. 
• 

  JWB

  I suppose anything that could not be explained scientifically to the beholder. Just as if someone transported from the 1st century to the 21st century would regard a tablet PC as a miracle. Some UK posters may remember a TV series by the name of Catweazle that featured a Merlin-like character who found himself in the modern world and proclaimed that 'electricity' was 'elec-trickery'!
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  cantleave, I'm glad you liked that! It just goes to show that there are so many ways that digital information can be stored.
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  falseprophet, well done!

  And for those of you still wondering:

  AA = _
  AC = a
  AG = b
  AT = c
  
  CA = d
  CC = e
  CG = f
  CT = g
  
  GA = h
  GC = i
  GG = j
  GT = k
  
  TA = l
  TC = m
  TG = n
  TT = o
  
  
  d n a _ c o d e _ o f _ l i f e
  
  CA (d) TG (n) AC (a) AA (_)

  AT (c) TT (o) CA (d) CC (e) AA (_)

  TT (o) CG (f) AA (_)

  TA (l) GC (i) CG (f) CC (e)

  This can also be used to store numbers too in base 4:

  AA = 00 (0)
  AC = 01 (1)
  AG = 02 (2)
  AT = 03 (3)
  CA = 10 (4)
  CC = 11 (5)
  CG = 12 (6)
  CT = 13 (7)
  GA = 20 (8)
  GC = 21 (9)
  GG = 22 (10)
  GT = 23 (11)
  TA = 30 (12)
  TC = 31 (13)
  TG = 32 (14)
  TT = 33 (15)

  ---

  Here is a real world example of using actually encoding secret messages into DNA. "These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like ‘v’ for ‘u’) were necessary":
  
  http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/
  
  An interesting idea for synthetic data storage within DNA:
  http://blog.longnow.org/02012/08/16/storing-digital-data-in-dna/
  
  (Do you remember those 'gel packs' in Star Trek Voyager? You know, the organic ones that supplemented the main computer's memory?)
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  Another hint: Each individual part of the code is a pair.