I discussed this matter many months' ago:
This gives information about how the WTS itself understands about the OSCE according to one of its own articles, as well as links to relevant documents.
Posts by JWB
-
19A question concerning the OSCE and the WTBTS.
by DATA-DOG infirst of all, here is a good link with some information.
http://perimeno.ca/letters_1107_osce.htm .
so, has anyone actually spoke to their elders about the un and the osce from a confused sheep angle?
-
-
-
4
The London Mill Hill Congregation Investigation 2008-09
by JWB inafter the extracts are links to news items relating to the case.. .
charities back on track.
themes and lessons from.
-
-
JWB
THE LONDON MILL HILL CONGREGATION INVESTIGATION 2008-09
The following extracts are taken from the 2008-09 edition of the UK Charity Commission's Annual Report called "Charities Back on Track". After the extracts are links to news items relating to the case.
---
CHARITIES BACK ON TRACK
_______________________
THEMES AND LESSONS FROM
THE CHARITY COMMISSION'S
COMPLIANCE WORK
2008-09
_______________________
[Page 14]
E4. PUTTING VULNERABLE BENEFICIARIES FIRST
Charity trustees have a legal duty of care to protect their charity. This includes a fundamental responsibility to ensure that vulnerable beneficiaries are protected from harm. Good intentions can be circumvented - it is vital that effective policies are in place and implemented. There can be no exceptions.
* A faith-based charity [1]
This charity, a branch of a worldwide religion, undertakes a range of religious activities including the provision of a place of worship and other facilities. Its trustee board appointed a member of its congregation as a fellow-trustee of the branch charity.
This individual was subsequently arrested and convicted of gross indecency and indecent assault on a number of child members of two other branches of the religious organisation, which had been committed prior to him joining this branch.
The Commission was made aware of the conviction by press coverage. Given the serious nature of these concerns and the potential risks to the charity's vulnerable beneficiaries, including children, we opened a statutory inquiry.
We found that, while the individual was still listed as one of the charity's trustees he had, in fact, been removed as a trustee by the other trustees when he was arrested.
The trustees also assured us that, while the individual was allowed to remain as a member of the congregation, they had ensured that he had no unsupervised access to children, young people or vulnerable adults in the congregation. They also explained that his actions were closely supervised and monitored.
Other charities might have decided to ask an individual in this position to remove themselves from the congregation, at least temporarily. This charity told us the religion places a high importance on personal redemption and thus the individual was allowed to remain with the safeguards in place.
Subsequently, the individual left the area and ceased to be a member of the charity's congregation. The trustees had informed the congregation nearest to his new home of his conviction and that congregation, in turn, has put in place supervisory measures.
The Commission required the charity to produce a child protection policy as the charity had no written policy in place. We are currently working with the charity's umbrella body to produce a full child protection policy which, when agreed, will be binding on all of the branches of the charity it represents.
__________
[1] We have not named this charity as we are working with its umbrella body to produce a full child protection policy.
_______________________
[Page 39]
Charity:
13 London Mill Hill
Congregation of Jehovah's
Witnesses (1065638)
Issue:
Trusteeship and governance issues
Vulnerable beneficiaries
Statutory Powers:
No powers used
Statutory inquiry durations:
11 months
---
A copy of the above referenced document can be found here:
http://jwleaks.files.wordpress.com/2012/07/charities-back-on-track-2009.pdf
A copy of "a statement of the results of an inquiry into the London Mill Hill Congregation of Jehovah’s Witnesses (1065638) and published on 3rd October 2008" can be found here:
http://jwleaks.files.wordpress.com/2012/07/london-mill-hill-ir-pub-date-03-10-08.pdf
---
NEWS ITEMS RELATING TO THE CASE
"Paedophile jailed after public outcry" - The Times, November 16, 2007.
http://www.times-series.co.uk/news/topstories/1838654.print/
"The number of sex offenders working as charity trustees trebles" - The Times, October 20, 2009.
http://www.timesonline.co.uk/tol/news/uk/crime/article6881322.ece -
22
Why do they call it the New World Translation?
by Tameria2001 indoes anyone know why the watchtower named their bible the new world translation of the holy scriptures?
it's been awhile since i have even had any of their books in my home, and most of the time i don't think about it.
i don't know why, but when i think of that title, the phrase new world order keeps popping up in my mind..
-
-
JWB
They also used to speak about the New World Society. I think Splash and skeeter1 make it fairly clear as to the "New World" part. As for 'translation', that is another matter.
-
89
Mouthy Grace is not well. Please send love.
by return of parakeet inin another thread, mouthy said she was "not well" and mentioned "kicking the bucket.
i believe she needs some encouragement and well wishes.. mouthy, you don't need to respond to this thread if you don't feel up to it.
just consider it an exceptionally long get-well card..
-
-
JWB
Get well soon Grace!
-
20
Their is no evidence/record of Jesus ever using Gods personal name , let alone making that personal name known during his 33 years of life on earth.
by smiddy injohn 17 :26 states "i have made your name known ".
just where and how many times in the christian greek scriptures has jesus made the personal name of god known .
he has had 33 years to do so you know.. in "the lords prayer" / "the our father prayer" jesus says of god "let your name be sanctified ", just where, and how many times in the christian greek scriptures does jesus sanctify or make known the personal name of god ?
-
-
JWB
Concerning the name 'Jehovah', The Interlinear NIV Hebrew-English Old Testament (1987 edition), published by Zondervan Publishing House, informs us on page xviii:
1) YHWH ("Yahweh," the proper name of God) is written either YHWH, pointed with the vowels of 'DNY ("Lord"), or YHWH pointed with the vowels of 'LHYM ("God"), and is to be pronounced as the word whose vowels it borrows. This deliberate mispointing was an effort by the scribes to make the name of God unpronounceable and thus keep it from being taken in vain (Exod. 20:7; Lev. 24:11). This device was misinterpreted in 1520 by one Galatinus who mixed the vowels of 'DNY with the consonants of YHWH, thus producing the hybrid form Jehovah, which has remained with us to this day. [Underlining mine]
As far as the Christian Greek Scriptures is concerned, there is no orginal Greek word that is synonymous with 'Jehovah'. There only exists 'kyrios' (lord). The WTS had no business adding the word 'Jehovah' to the text. If they wanted to give the suggestion that certain occurrences of 'kyrios' referred to 'Jehovah' they could always have capitalised such in the English text (ie LORD instead of Lord). -
13
Establishing the Premises Regarding "Jehovah's Channel"
by Ding intypically, when the topic of new light arises in discussions with a jw, it come about this way:.
1. wt critic cites discarded doctrines or false prophecies to the jw in order to undermine his faith in the gb.. 2. jw counters by citing proverbs 4:18, saying that changes are fine because the light gets brighter and brighter.. 3. wt critic gets frustrated because any sort of nonsense can be overlooked via that type of thought-stopping "logic.".
perhaps a better approach is to start by asking the jw to explain how the "jehovah's channel of communication" process works.
-
-
JWB
Ding, you know what for me finally broke the whole "we're in charge 'cause the Bible say so" thing? It was simply this:
The spiritual authority they claim for themselves is fundamentally dependent upon the seven times doctrine based on the fourth chapter of Daniel. Once you realize that their "second fulfillment" teaching is an extra-biblical one, the complete edifice falls down. Daniel chapter four itself explains how the prophecy was fulfilled in Nebuchadnezzar himself with no loose strings to tie up. They grab at straws to force the chapter to say what it does not. Without the backing of this doctrine there is no 1914 pivotal date, nor the supposed prophesied activities that would give evidence of divine selection!
So now, instead of concerning myself about the intricacies of explaining the errors in various doctrines and the questionable history of the organization, I would simply say the following to a JW:
"Unless the Bible explicitly says so, I don't believe in second fulfillments of Bible prophecy including the one about the seven times in Daniel chapter four. Therefore I cannot see any convincing Biblical evidence for believing that the Watch Tower Society has been chosen as an instrument of God." -
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
-
JWB
DNA CODONS: AMINO ACIDS (1)
Id Sym Name Codon(s) A Ala alanine GCT, GCC, GCA, GCG C Cys cysteine TGT, TGC D Asp aspartic acid GAT, GAC E Glu glutamic acid GAA, GAG F Phe phenylalaline TTT, TTC G Gly glycine GGT, GGC, GGA, GGG H His histidine CAT, CAC I Ile isoleucine ATT, ATC, ATA K Lys lysine AAA, AAG L Leu leucine TTA, TTG, CTT, CTC, CTA, CTG M Met methianine ATG (also used as start code) N Asn asparagine AAT, AAC P Pro proline CCT, CCC, CCA, CCG Q Gln glutamine CAA, CAG R Arg arginine CGT, CGC, CGA, CGG, AGA, AGG S Ser serine TCT, TCC, TCA, TCG, AGT, AGC T Thr threonine ACT, ACC, ACA, ACG V Val valine GTT, GTC, GTA, GTG W Trp tryptophane TGG Y Tyr tyrosine TAT, TAC _ - (stop code) TAA, TGA, TAG DNA CODONS: AMINO ACIDS (2)
Id Sym Name Codon # F Phe phenylalaline TTT 01 F Phe phenylalaline TTC 02 L Leu leucine TTA 03 L Leu leucine TTG 04 S Ser serine TCT 05 S Ser serine TCC 06 S Ser serine TCA 07 S Ser serine TCG 08 Y Tyr tyrosine TAT 09 Y Tyr tyrosine TAC 10 _ - (stop code) TAA 11 _ - (stop code) TAG 12 C Cys cysteine TGT 13 C Cys cysteine TGC 14 _ - (stop code) TGA 15 W Trp tryptophane TGG 16 L Leu leucine CTT 17 L Leu leucine CTC 18 L Leu leucine CTA 19 L Leu leucine CTG 20 P Pro proline CCT 21 P Pro proline CCC 22 P Pro proline CCA 23 P Pro proline CCG 24 H His histidine CAT 25 H His histidine CAC 26 Q Gln glutamine CAA 27 Q Gln glutamine CAG 28 R Arg arginine CGT 29 R Arg arginine CGC 30 R Arg arginine CGA 31 R Arg arginine CGG 32 I Ile isoleucine ATT 33 I Ile isoleucine ATC 34 I Ile isoleucine ATA 35 M Met methianine* ATG 36 T Thr threonine ACT 37 T Thr threonine ACC 38 T Thr threonine ACA 39 T Thr threonine ACG 40 N Asn asparagine AAT 41 N Asn asparagine AAC 42 K Lys lysine AAA 43 K Lys lysine AAG 44 S Ser serine AGT 45 S Ser serine AGC 46 R Arg arginine AGA 47 R Arg arginine AGG 48 V Val valine GTT 49 V Val valine GTC 50 V Val valine GTA 51 V Val valine GTG 52 A Ala alanine GCT 53 A Ala alanine GCC 54 A Ala alanine GCA 55 A Ala alanine GCG 56 D Asp aspartic acid GAT 57 D Asp aspartic acid GAC 58 E Glu glutamic acid GAA 59 E Glu glutamic acid GAG 60 G Gly glycine GGT 61 G Gly glycine GGC 62 G Gly glycine GGA 63 G Gly glycine GGG 64 * also used as start code
-
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
-
JWB
Well, maybe the second challenge was a bit ambiguous, so I'll make it very easy. Please see the tables below.
-
56
I wanted to punch this elder so bad!
by OneDayillBeFree inso i decided to attend the meeting last.
since i haven't gone in about 2 weeks, and i leave as soon as it ends, and elder decided to corner me at the end.
lately i've been through some very depressing family issues that are non-jw related so i haven't been my best at acting like i care about the org.
-
-
JWB
He [O'Brien] paused for a few moments, as though to allow what he had been saying to sink in.
'Do you remember,' he went on, 'writing in your diary, "Freedom is the freedom to say that two plus two make four"?'
'Yes,' said Winston.
O'Brien held up his left hand, its back towards Winston, with the thumb hidden and the four fingers extended.
'How many fingers am I holding up, Winston?'
'Four.'
'And if the party says that it is not four but five -- then how many?'
'Four.'
The word ended in a gasp of pain. The needle of the dial had shot up to fifty-five. The sweat had sprung out all over Winston's body. The air tore into his lungs and issued again in deep groans which even by clenching his teeth he could not stop. O'Brien watched him, the four fingers still extended. He drew back the lever. This time the pain was only slightly eased.
'How many fingers, Winston?'
'Four.'
The needle went up to sixty.
'How many fingers, Winston?'
'Four! Four! What else can I say? Four!'
The needle must have risen again, but he did not look at it. The heavy, stern face and the four fingers filled his vision. The fingers stood up before his eyes like pillars, enormous, blurry, and seeming to vibrate, but unmistakably four.
'How many fingers, Winston?'
'Four! Stop it, stop it! How can you go on? Four! Four!'
'How many fingers, Winston?'
'Five! Five! Five!'
'No, Winston, that is no use. You are lying. You still think there are four. How many fingers, please?'
'Four! five! Four! Anything you like. Only stop it, stop the pain!'
http://www.george-orwell.org/1984/18.html -
22
Can anyone decode this?
by JWB incan anyone decode this?.
catgacaaatttcaccaattcgaatagccgcc.
this is not a trick question.
-
-
JWB
Tf, I watched the above-mentioned video. I was interested in the comment about the possibility of a real matrix-style world based on natural hidden "computer codes". I understand that our perception of 'reality' is only that which our mind decides based on the information coming to the brain via our senses. This is why when we hear someone talking to us on the phone it seems as if we are actually hearing their voice, but really we are only getting a copy of the sounds they make after the coding and decoding processes necessary for sending data down telephone lines and the reconstruction made in the speaker contained in the earpiece.
Dr Gates makes the observation that if you "fall in love" with something you will naturally want to pursue it. This is something I discovered about myself when it came to computers and coding. This was some decades ago. Personal computers and programmable games machines were starting to become more affordable and naturally I wanted a computer of my own!
I wasn't interested in playing games, I just wanted to be able to create something. I got some books out of the library and started to understand how computers stored information. The complex architecture and system necessary to even output one character to the screen had my mind swirling at first. Thankfully we had reached a point in history where it was no longer necessary to labour with machine code as high level computer languages were available to take out much of the pain. Nevertheless I had to wait some years later before the convenience and speed afforded by Integrated Development Environments (IDEs) and Rapid Application Development Tools (RADs) came along.
After going 'back to college' and getting a formal education in systems development, I ended up spending the last 20 years or so being involved in computer information systems, first in application development, then in systems administration. I've witnessed huge leaps in technology, but at the base level I realise that all of this could not have taken place unless there had been some very brilliant minds involved. My interest in DNA is as a result of my computer background, and particularly because of my exposure to the intricacies of software development. I see in DNA and RNA similarities with machine code. For example, there is data storage and retrieval as well as data reading/writing 'start' and 'stop' codes. As Spock would say, "Fascinating!"
---
If anyone is interesting in another code challenge, see if you can decode this message:
TGTGTTGATGTTAATATGGAATCTTCTGCTGGTGAATCTGCTCGTGAAGGTCGTGAAGCTACT
The only clues I'll give are: (1) The method of solving the problem is not the same as the first challenge, and (2) you will need to have a basic understanding of DNA 'codons' and certain information pertaining to them.
This is possibly easier than the first challenge, but no guesses allowed as I expect you to explain how you cracked the code this time!