JWB

Joined

• started 56 topics
• posted 319 times   see topics posted on
• send a message

Posts by JWB

• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  No takers?

  Well, here's the answer:

  DNA MESSAGE 2
  
  TGTGTTGATGTTAATATGGAATCTTCTGCTGGTGAATCTGCTCGTGAAGGTCGTGAAGCTACT
  
  A | Ala | alanine | GCT, GCC, GCA, GCG
  C | Cys | cysteine | TGT, TGC
  D | Asp | aspartic acid | GAT, GAC
  E | Glu | glutamic acid | GAA, GAG
  F | Phe | phenylalaline | TTT, TTC
  G | Gly | glycine | GGT, GGC, GGA, GGG
  H | His | histidine | CAT, CAC
  I | Ile | isoleucine | ATT, ATC, ATA
  K | Lys | lysine | AAA, AAG
  L | Leu | leucine | TTA, TTG, CTT, CTC, CTA, CTG
  M | Met | methianine | ATG (also used as start code)
  N | Asn | asparagine | AAT, AAC
  P | Pro | proline | CCT, CCC, CCA, CCG
  Q | Gln | glutamine | CAA, CAG
  R | Arg | arginine | CGT, CGC, CGA, CGG, AGA, AGG
  S | Ser | serine | TCT, TCC, TCA, TCG, AGT, AGC
  T | Thr | threonine | ACT, ACC, ACA, ACG
  V | Val | valine | GTT, GTC, GTA, GTG
  W | Trp | tryptophane | TGG
  Y | Tyr | tyrosine | TAT, TAC
  _ | | (stop code) | TAA, TGA, TAG
  
  c v d v n
  TGT GTT GAT GTT AAT
  m e s s a g e s
  ATG GAA TCT TCT GCT GGT GAA TCT
  a r e
  GCT CGT GAA
  g r e a t
  GGT CGT GAA GCT ACT
  
  codon messages are great
  
  Note: Since there is no amino acid with an 'o' as a one-letter symbol, I chose v because of its similarity with u, and u because of its similarity with o.
• 
  37

  July KM - Jehovah's heart scanner in action

  by respectful_observer in

  1. watchtower
  2. beliefs

  excerpt from july 2013 km article "new initiatives for public witnessing".

  4 how the witnessing is done: those.

  involved in special metropolitan public.

  1. 
  2. 
  3. 
• 

  JWB

  I hardly think that the Omniscient One (OO) would have to do a scan on Someone's Heart (SH)!
  
  OO: Here comes the next person. SH, do you have anything to declare?
  
  SH: No, you already know what's in here.
  
  OO: Well, I'll still have to do a scan.
  
  SH: Why?
  
  OO: Well, because its necessary before I can decide whether you should talk to My People at the desk.
  
  SH: And then?
  
  OO: If you've got a bad heart, then I'll move you on past My People so as not to waste their time. Otherwise, my Spirit (with the help of the angels of course) will incline you and your host to move into the direction of the desk to discover the latest edition of Truth(tm).
  
  ---
  
  For Mary:
  
  "Its life Jim, but not as we know it!"
• 
  150

  YHWH v YHVH - yes, V not W

  by *lost* in

  1. watchtower
  2. bible

  god's real name and identity yhvh.

  yhwh - fraudulent identity.. .

  can we all sue wt for evidenced fraud and deliberate deception ??

  1. 
  2. 
  3. 
• 

  JWB

  Lost, please can you enlighten me as to your statement: "There is no ''W'' sound in Hebrew"? Are you referring to modern Hebrew? If so, okay. But I have difficulty believing that the ancient Hebrews didn't have a W sound. The reason for this is that the Waw (Vav) character was used at times to form 'O' and 'U'. This seems reasonable considering that W, O, and U have a relationship in terms of how the mouth produces the sounds. As you are probably aware, many languages over time change the way consonants and vowels are pronounced. One such change is from the I/Y to J. This has happened in the case of Jehovah, where the original I has become J. As another example, many English words that begin with J have actually come from Latin words that began with an I. So I'm intrigued as to the statement you made. I'm not trying to cause an argument, but I simply wish to know if I've missed something here.
• 
  19

  A question concerning the OSCE and the WTBTS.

  by DATA-DOG in

  1. watchtower
  2. bible

  first of all, here is a good link with some information.

  http://perimeno.ca/letters_1107_osce.htm .

  so, has anyone actually spoke to their elders about the un and the osce from a confused sheep angle?

  1. 
  2. 
  3. 
• 

  JWB

  I discussed this matter many months' ago:

  http://www.jehovahs-witness.net/watchtower/scandals/239364/1/The-European-Association-of-Jehovahs-Christian-Witnesses-and-the-OSCE

  This gives information about how the WTS itself understands about the OSCE according to one of its own articles, as well as links to relevant documents.
• 
  4

  The London Mill Hill Congregation Investigation 2008-09

  by JWB in

  1. watchtower
  2. child-abuse

  after the extracts are links to news items relating to the case.. .

  charities back on track.

  themes and lessons from.

  1. 
  2. 
  3. 
• 

  JWB

  THE LONDON MILL HILL CONGREGATION INVESTIGATION 2008-09
  
  The following extracts are taken from the 2008-09 edition of the UK Charity Commission's Annual Report called "Charities Back on Track". After the extracts are links to news items relating to the case.
  
  ---
  
  CHARITIES BACK ON TRACK
  _______________________
  
  THEMES AND LESSONS FROM
  THE CHARITY COMMISSION'S
  COMPLIANCE WORK
  2008-09
  _______________________
  
  [Page 14]
  
  E4. PUTTING VULNERABLE BENEFICIARIES FIRST
  
  Charity trustees have a legal duty of care to protect their charity. This includes a fundamental responsibility to ensure that vulnerable beneficiaries are protected from harm. Good intentions can be circumvented - it is vital that effective policies are in place and implemented. There can be no exceptions.
  
  * A faith-based charity [1]
  
  This charity, a branch of a worldwide religion, undertakes a range of religious activities including the provision of a place of worship and other facilities. Its trustee board appointed a member of its congregation as a fellow-trustee of the branch charity.
  
  This individual was subsequently arrested and convicted of gross indecency and indecent assault on a number of child members of two other branches of the religious organisation, which had been committed prior to him joining this branch.
  
  The Commission was made aware of the conviction by press coverage. Given the serious nature of these concerns and the potential risks to the charity's vulnerable beneficiaries, including children, we opened a statutory inquiry.
  
  We found that, while the individual was still listed as one of the charity's trustees he had, in fact, been removed as a trustee by the other trustees when he was arrested.
  
  The trustees also assured us that, while the individual was allowed to remain as a member of the congregation, they had ensured that he had no unsupervised access to children, young people or vulnerable adults in the congregation. They also explained that his actions were closely supervised and monitored.
  
  Other charities might have decided to ask an individual in this position to remove themselves from the congregation, at least temporarily. This charity told us the religion places a high importance on personal redemption and thus the individual was allowed to remain with the safeguards in place.
  
  Subsequently, the individual left the area and ceased to be a member of the charity's congregation. The trustees had informed the congregation nearest to his new home of his conviction and that congregation, in turn, has put in place supervisory measures.
  
  The Commission required the charity to produce a child protection policy as the charity had no written policy in place. We are currently working with the charity's umbrella body to produce a full child protection policy which, when agreed, will be binding on all of the branches of the charity it represents.
  __________
  
  [1] We have not named this charity as we are working with its umbrella body to produce a full child protection policy.
  _______________________
  [Page 39]
  
  Charity:
  
  13 London Mill Hill
  Congregation of Jehovah's
  Witnesses (1065638)
  
  Issue:
  
  Trusteeship and governance issues
  Vulnerable beneficiaries
  
  Statutory Powers:
  
  No powers used
  
  Statutory inquiry durations:
  
  11 months
  ---
  
  A copy of the above referenced document can be found here:
  
  http://jwleaks.files.wordpress.com/2012/07/charities-back-on-track-2009.pdf
  
  A copy of "a statement of the results of an inquiry into the London Mill Hill Congregation of Jehovah’s Witnesses (1065638) and published on 3rd October 2008" can be found here:
  
  http://jwleaks.files.wordpress.com/2012/07/london-mill-hill-ir-pub-date-03-10-08.pdf
  
  ---
  
  NEWS ITEMS RELATING TO THE CASE
  
  "Paedophile jailed after public outcry" - The Times, November 16, 2007.
  http://www.times-series.co.uk/news/topstories/1838654.print/
  
  "The number of sex offenders working as charity trustees trebles" - The Times, October 20, 2009.
  
  http://www.timesonline.co.uk/tol/news/uk/crime/article6881322.ece
• 
  22

  Why do they call it the New World Translation?

  by Tameria2001 in

  1. jw
  2. friends

  does anyone know why the watchtower named their bible the new world translation of the holy scriptures?

  it's been awhile since i have even had any of their books in my home, and most of the time i don't think about it.

  i don't know why, but when i think of that title, the phrase new world order keeps popping up in my mind..

  1. 
  2. 
  3. 
• 

  JWB

  They also used to speak about the New World Society. I think Splash and skeeter1 make it fairly clear as to the "New World" part. As for 'translation', that is another matter.
• 
  89

  Mouthy Grace is not well. Please send love.

  by return of parakeet in

  1. jw
  2. friends

  in another thread, mouthy said she was "not well" and mentioned "kicking the bucket.

  i believe she needs some encouragement and well wishes.. mouthy, you don't need to respond to this thread if you don't feel up to it.

  just consider it an exceptionally long get-well card..

  1. 
  2. 
  3. 
• 

  JWB

  Get well soon Grace!
• 
  20

  Their is no evidence/record of Jesus ever using Gods personal name , let alone making that personal name known during his 33 years of life on earth.

  by smiddy in

  1. jw
  2. friends

  john 17 :26 states "i have made your name known ".

  just where and how many times in the christian greek scriptures has jesus made the personal name of god known .

  he has had 33 years to do so you know.. in "the lords prayer" / "the our father prayer" jesus says of god "let your name be sanctified ", just where, and how many times in the christian greek scriptures does jesus sanctify or make known the personal name of god ?

  1. 
  2. 
  3. 
• 

  JWB

  Concerning the name 'Jehovah', The Interlinear NIV Hebrew-English Old Testament (1987 edition), published by Zondervan Publishing House, informs us on page xviii:
  
  1) YHWH ("Yahweh," the proper name of God) is written either YHWH, pointed with the vowels of 'DNY ("Lord"), or YHWH pointed with the vowels of 'LHYM ("God"), and is to be pronounced as the word whose vowels it borrows. This deliberate mispointing was an effort by the scribes to make the name of God unpronounceable and thus keep it from being taken in vain (Exod. 20:7; Lev. 24:11). This device was misinterpreted in 1520 by one Galatinus who mixed the vowels of 'DNY with the consonants of YHWH, thus producing the hybrid form Jehovah, which has remained with us to this day. [Underlining mine]
  
  As far as the Christian Greek Scriptures is concerned, there is no orginal Greek word that is synonymous with 'Jehovah'. There only exists 'kyrios' (lord). The WTS had no business adding the word 'Jehovah' to the text. If they wanted to give the suggestion that certain occurrences of 'kyrios' referred to 'Jehovah' they could always have capitalised such in the English text (ie LORD instead of Lord).
• 
  13

  Establishing the Premises Regarding "Jehovah's Channel"

  by Ding in

  1. watchtower
  2. beliefs

  typically, when the topic of new light arises in discussions with a jw, it come about this way:.

  1. wt critic cites discarded doctrines or false prophecies to the jw in order to undermine his faith in the gb.. 2. jw counters by citing proverbs 4:18, saying that changes are fine because the light gets brighter and brighter.. 3. wt critic gets frustrated because any sort of nonsense can be overlooked via that type of thought-stopping "logic.".

  perhaps a better approach is to start by asking the jw to explain how the "jehovah's channel of communication" process works.

  1. 
  2. 
  3. 
• 

  JWB

  Ding, you know what for me finally broke the whole "we're in charge 'cause the Bible say so" thing? It was simply this:
  
  The spiritual authority they claim for themselves is fundamentally dependent upon the seven times doctrine based on the fourth chapter of Daniel. Once you realize that their "second fulfillment" teaching is an extra-biblical one, the complete edifice falls down. Daniel chapter four itself explains how the prophecy was fulfilled in Nebuchadnezzar himself with no loose strings to tie up. They grab at straws to force the chapter to say what it does not. Without the backing of this doctrine there is no 1914 pivotal date, nor the supposed prophesied activities that would give evidence of divine selection!
  
  So now, instead of concerning myself about the intricacies of explaining the errors in various doctrines and the questionable history of the organization, I would simply say the following to a JW:
  
  "Unless the Bible explicitly says so, I don't believe in second fulfillments of Bible prophecy including the one about the seven times in Daniel chapter four. Therefore I cannot see any convincing Biblical evidence for believing that the Watch Tower Society has been chosen as an instrument of God."
• 
  22

  Can anyone decode this?

  by JWB in

  1. social
  2. entertainment

  can anyone decode this?.

  catgacaaatttcaccaattcgaatagccgcc.

  this is not a trick question.

  1. 
  2. 
  3. 
• 

  JWB

  DNA CODONS: AMINO ACIDS (1)

  Id	Sym	Name	Codon(s)
  A	Ala	alanine	GCT, GCC, GCA, GCG
  C	Cys	cysteine	TGT, TGC
  D	Asp	aspartic acid	GAT, GAC
  E	Glu	glutamic acid	GAA, GAG
  F	Phe	phenylalaline	TTT, TTC
  G	Gly	glycine	GGT, GGC, GGA, GGG
  H	His	histidine	CAT, CAC
  I	Ile	isoleucine	ATT, ATC, ATA
  K	Lys	lysine	AAA, AAG
  L	Leu	leucine	TTA, TTG, CTT, CTC, CTA, CTG
  M	Met	methianine	ATG (also used as start code)
  N	Asn	asparagine	AAT, AAC
  P	Pro	proline	CCT, CCC, CCA, CCG
  Q	Gln	glutamine	CAA, CAG
  R	Arg	arginine	CGT, CGC, CGA, CGG, AGA, AGG
  S	Ser	serine	TCT, TCC, TCA, TCG, AGT, AGC
  T	Thr	threonine	ACT, ACC, ACA, ACG
  V	Val	valine	GTT, GTC, GTA, GTG
  W	Trp	tryptophane	TGG
  Y	Tyr	tyrosine	TAT, TAC
  _	-	(stop code)	TAA, TGA, TAG

  DNA CODONS: AMINO ACIDS (2)

  Id	Sym	Name	Codon	#
  F	Phe	phenylalaline	TTT	01
  F	Phe	phenylalaline	TTC	02
  L	Leu	leucine	TTA	03
  L	Leu	leucine	TTG	04
  S	Ser	serine	TCT	05
  S	Ser	serine	TCC	06
  S	Ser	serine	TCA	07
  S	Ser	serine	TCG	08
  Y	Tyr	tyrosine	TAT	09
  Y	Tyr	tyrosine	TAC	10
  _	-	(stop code)	TAA	11
  _	-	(stop code)	TAG	12
  C	Cys	cysteine	TGT	13
  C	Cys	cysteine	TGC	14
  _	-	(stop code)	TGA	15
  W	Trp	tryptophane	TGG	16
  L	Leu	leucine	CTT	17
  L	Leu	leucine	CTC	18
  L	Leu	leucine	CTA	19
  L	Leu	leucine	CTG	20
  P	Pro	proline	CCT	21
  P	Pro	proline	CCC	22
  P	Pro	proline	CCA	23
  P	Pro	proline	CCG	24
  H	His	histidine	CAT	25
  H	His	histidine	CAC	26
  Q	Gln	glutamine	CAA	27
  Q	Gln	glutamine	CAG	28
  R	Arg	arginine	CGT	29
  R	Arg	arginine	CGC	30
  R	Arg	arginine	CGA	31
  R	Arg	arginine	CGG	32
  I	Ile	isoleucine	ATT	33
  I	Ile	isoleucine	ATC	34
  I	Ile	isoleucine	ATA	35
  M	Met	methianine*	ATG	36
  T	Thr	threonine	ACT	37
  T	Thr	threonine	ACC	38
  T	Thr	threonine	ACA	39
  T	Thr	threonine	ACG	40
  N	Asn	asparagine	AAT	41
  N	Asn	asparagine	AAC	42
  K	Lys	lysine	AAA	43
  K	Lys	lysine	AAG	44
  S	Ser	serine	AGT	45
  S	Ser	serine	AGC	46
  R	Arg	arginine	AGA	47
  R	Arg	arginine	AGG	48
  V	Val	valine	GTT	49
  V	Val	valine	GTC	50
  V	Val	valine	GTA	51
  V	Val	valine	GTG	52
  A	Ala	alanine	GCT	53
  A	Ala	alanine	GCC	54
  A	Ala	alanine	GCA	55
  A	Ala	alanine	GCG	56
  D	Asp	aspartic acid	GAT	57
  D	Asp	aspartic acid	GAC	58
  E	Glu	glutamic acid	GAA	59
  E	Glu	glutamic acid	GAG	60
  G	Gly	glycine	GGT	61
  G	Gly	glycine	GGC	62
  G	Gly	glycine	GGA	63
  G	Gly	glycine	GGG	64

  * also used as start code